viernes, 28 de agosto de 2015

El mayor evento de divulgación científica: Naukas Bilbao 2015

#Naukas15

Contar historias y hablar de ciencia, una pasión común en los profesores, investigadores o profesionales que colaboramos con una de las mejores (quizá la mejor!) plataformas de divulgación científica en lengua castellana: Naukas. Ciencia, escepticismo y humor es lo que figura en su tarjeta de presentación. La ciencia que se publica en Naukas va más allá de la mera y necesaria divulgación. Si algo importante ocurre en ciencia, lo sabrás en Naukas. Si alguna noticia científica salta a las páginas de la prensa tradicional pueden ocurrir dos cosas: que sea cierta y en ese caso ya ha sido publicada en Naukas; o que sea falsa, en cuyo caso, alguno de los divulgadores de la plataforma lo explicará con rigor.

Otro año más se celebra el mayor evento de divulgación científica en España: Naukas Bilbao 2015. Organizado por la plataforma de divulgación científica Naukas y la Cátedra de Cultura Científica de la UPV/EHU, tendrá lugar los días 11 y 12 de septiembre, en la sala Mitxelena del Bizkaia Aretoa de la UPV/EHU (Av. Abandoibarra, 3 - Bilbao).


Comienza el mismo viernes 11 a las 10:00 de la mañana y hasta el sábado a las 20:30 podrás disfrutar de más de 60 apasionantes charlas de 10 minutos de ciencia y humor, además de monólogos, entrevistas y alguna que otra sorpresa.

Aquí puedes consultar el programa completo.

Este año además no podían faltar las sesiones especiales en paralelo para los más curiosos de la casa: Naukas Kids, humor, ciencia y diversión para los más pequeños (y no tan pequeños). Programa de charlas Naukas Kids.
  
Como novedad, además en esta edición se ofrece la posibilidad de asistir gratuitamente a un taller sobre ilustración e infografía científica que será impartido por Vega Asencio (NorArte).

Si el sábado día 12 a las 13:00 estás por Bilbao, pásate por #Naukas15 y verás la apasionante y divertida charla de microBIO sobre “Somos virus”.

El año pasado también participamos: ¿qué relación tiene la Gran Extinción que ocurrió en el planeta hace 250 millones de años, los canguros y la explosión el 27 de enero de 2014 de una granja de 90 vacas en la pequeña ciudad de alemana Rasdorf?

¿Por qué explotan las granjas de vacas?
(La charla de microBIO en #Naukas14)



Fecha: viernes 11 y sábado 12 de septiembre de 2015
Hora: todo el día desde las 10:00 h
Lugar: Paraninfo del UPV/EUH (Avenida Abandoibarra, 3 - 48009 Bilbao)

La entrada es LIBRE y GRATUITA hasta completar el aforo, 500 plazas aprox. (SE LLENA)

lunes, 24 de agosto de 2015

Fraude científico e interpretación de la ciencia

A lo largo de varias semanas Joaquín Sevilla (@Joaquin_Sevilla), Doctor en Ciencias Físicas y Profesor Titular de Tecnología electrónica en la Universidad Pública de Navarra, ha publicado en Cuaderno de Cultura Científica, un blog de la Cátedra de Cultura Científica de la UPV/EHU, unas reflexiones muy acertadas sobre el fraude científico.

Me he permitido recoger aquí juntas todas las entradas para que puedas leerlas. Su lectura es muy recomendable si te dedicas a esto de la ciencia, … y si no también:







Las malas prácticas científicas constituyen un continuo sin fronteras definidas. Sobre él se puede encontrar un umbral de lo aceptable individual y socialmente. El umbral no es fijo.

 Quizá te pueda interesar también estas otras entradas de microBIO:


jueves, 30 de julio de 2015

La evolución conjunta de Mycobacterium tuberculosis y Homo sapiens


¿Puede ser Mycobacterium tuberculosis un patógeno humano y un simbionte al mismo tiempo?

Mycobacterium tuberculosis es el agente causante de la tuberculosis, un viejo conocido del ser humano. Se calcula que actualmente un tercio de la población mundial tiene la enfermedad latente y, después del VIH, es el agente infeccioso que más gente mata: en el año 2001 contrajeron tuberculosis unos 8,8 millones de personas y 1,3 millones murieron.


Mycobacterium tuberculosis (naranja) unido a la superficie de un macrófago (verde). Referencia: Kaufmann S.H.E. Nature. 2008 May 15;453: 295-6. Figura: Volker Brinkmann, Core Facility Microscopy, Max Planck Institute for Infection Biology, Berlin.

Más de 2.000 millones de personas están infectadas por Mycobacterium tuberculosis, pero "solo" causa unos 1,3 millones de muertes cada año

El permanecer latente en el organismo es una de las características de la tuberculosis humana. La mayoría de la gente infectada con Mycobacterium desarrolla una respuesta inmune que controla la replicación de la bacteria, desarrollando un infección persiste sin síntomas de la enfermedad. Se ha sugerido incluso que la latencia de Mycobacterium puede suponer un estimulo beneficioso del sistema inmune de la persona infectada, que le protegería frente a otras posibles infecciones. En realidad la enfermedad se reactivará y se manifestará en sólo una pequeña cantidad de personas infectadas, frecuentemente varias décadas después de la infección inicial. Controlar la replicación de la bacteria y mantenerla latente es, por tanto, una forma de que el huésped evite la virulencia del patógeno. Sin embargo, la latencia también podría haber evolucionado como una estrategia del patógeno para asegurar su propia transmisión y evitar su extinción en poblaciones pequeñas de personas. En este sentido, Mycobacterium ha desarrollado varios mecanismos para sobrevivir durante la latencia dentro del huésped.

Por esta razón, la latencia parece ser el resultado de una co-evolución o evolución conjunta del huésped y del patógeno, de la interacción entre los dos. Los cambios evolutivos en el patógeno para aumentar su infectividad han sido contrarrestados por cambios evolutivos en el huésped para incrementar la resistencia a la infección. A lo largo de la evolución, el patógeno ha regulado su virulencia para hacer posible su persistencia y difusión en las poblaciones humanas que cada vez aumentaban en densidad y resistencia a la infección. Por una parte, la bacteria ha tenido que evolucionar para poder resistir al sistema inmune del huésped, pero manteniendo su capacidad de transmitirse en la población y no extinguirse. Para que la bacteria pueda transmitirse es necesaria la enfermedad, algo que depende también de la densidad de la población.

El complejo Mycobacterium tuberculosis está formado por un grupo de especies y sub-especies bacterianas que comparten entre sí más de 99% de identidad genética, pero que se diferencian en el rango de huésped primario, es decir, en el tipo de animal que infectan. Algunas especies infectan al hombre, otras están adaptadas exclusivamente a los animales

Las formas adaptadas al ser humano son Mycobacterium tuberculosis  (en sentido estricto) y Mycobacterium africanum, esta última de menor virulencia. Los análisis filogenéticos de las mycobacterias humanas demuestran que existen varios linajes que divergen de un mismo ancestro común y que se diversifican en distintas regiones geográficas.

Existen varios linajes de Mycobacterium tuberculosis que se diversifican en distintas regiones geográficas


Análisis filogenético de 220 cepas del complejo Mycobacterium tuberculosis (ref. 1)

Un grupo está formado por las cepas más “modernas” e incluye tres linajes separados: linaje 4 (Euro-Americano), linaje 2 (este asiático) y el linaje 3 (este de África y Asia central). Las cepas de los linajes 2 y 4 son responsables de la mayoría de los casos de tuberculosis humana que ocurren actualmente en el mundo, y de los brotes de tuberculosis multirresistente a los antibióticos. Esto puede ser un reflejo de su éxito evolutivo y de que son linajes mejor adaptados al ser humano actual.

Las cepas más “antiguas” incluye los linajes 1 (Indo-Oceánico), los linajes 5 y 6 de Mycobacterium africanum (oeste de África) y el linaje 7 (Etiopía). El linaje 1 parece ser el más antiguo. Las cepas de los linajes modernos son más virulentas que las de los linajes antiguos.

A diferencia de las adaptadas al hombre, las mycobacterias adaptadas a los animales son capaces de establecer infecciones y de transmitirse entre especies distintas de animales. Las mycobacterias aisladas de animales son: Mycobacterium microti (en ratones, topillos, musarañas y gatos), Mycobacterium pinnipedii (en focas y leones marinos), Mycobacterium caprae (en cabras y ciervos), Mycobacterium bovis (en ganados y otros animales domésticos y salvajes), Mycobacterium orygis (en oris, gacelas, venados, antílopes, búfalos, …), Mycobacterium mungi (en mangostas), y Mycobacterium suricattae (en suricatas). También se han asilado mycobacterias de chimpancés salvajes. Todas estas cepas parecen tener un mismo origen y están relacionadas con los linajes 5 y 6 de Mycobacterium africanum.

Mycobacterium tuberculosis no se originó 
a partir de Mycobacterium bovis

Hace años se pensaba que los humanos habíamos adquirido el bacilo de la tuberculosis durante el Neolítico partir del ganado durante la domesticación de los animales, y que, por tanto, Mycobacterium tuberculosis provenía de Mycobacterium bovis. En realidad el origen es el contrario. Los análisis genómicos demuestran que Mycobacterium bovis ha perdido varios genes todavía presentes en Mycobacterium tuberculosis, y que por tanto las especies adaptadas al hombre son anteriores y más antiguas que Mycobacterium bovis y otras mycobacterias animales, que surgieron posteriormente.

El hecho de que los linajes africanos y las cepas animales sean los de mayor diversidad genética sugiere que el origen de Mycobacterium está en África. La mayoría de los linajes animales afectan a animales salvajes africanos, mientras que los linajes adaptados a animales domésticos están más repartidos, probablemente como consecuencia de las migraciones humanas y del comercio.

El origen común (monofilético) y la marcada distribución geográfica de las cepas de Mycobacterium sugiere que estas bacterias podrían haber acompañado a las primeras migraciones humanas en su salida de África y haberse diversificado conjuntamente con las poblaciones humanas.  Sin embargo, parece que algunos linajes son más “generalistas” y son capaces de persistir en diferentes poblaciones humanas, mientras que otros son más “especializados” y solo persisten en determinadas poblaciones.


Relaciones evolutivas entre miembros del complejo Mycobacterium tuberculosis (ref. 2)

El origen de la tuberculosis humana es africano

Los estudios de las filogenias de genomas de distintos linajes de Mycobacterium permiten estimar que la edad del ancestro común a todo el complejo Mycobacterium es de unos 73.000 años. Los datos sugieren que el linaje 1  se separó del resto hace unos 67.000 años, coincidiendo con la primera migración humana de África. Los linajes 2 y 4 se separaron hace unos 30.000-46.000 años y 32.000-42.000 años, respectivamente, lo que se correlaciona con la primera evidencia arqueológica de presencia de humanos modernos en Europa y este de Asia, respectivamente. Mycobacterium bovis se separó de una rama relacionada con Mycobacterium africanum (linajes 5 y 6). Los linajes 2, 3 y 4 comparten todos ellos una misma deleción, TbD1.

También existen datos de restos arqueológicos de lesiones óseas consistentes con infecciones por tuberculosis y evidencias moleculares de la presencia de genoma de la bacteria en dichos restos. La evidencia molecular más antigua es la presencia de DNA de Mycobacterium en huesos de bisonte de hace 17.500 años encontrado en Wyoming (EE.UU.). También se ha encontrado DNA de la bacteria en esqueletos humanos de hace 9.000 años en Israel, otros de hace unos 7.000 años encontrados en Alemania, y en momias egipcias de 4.000 años de antigüedad. La presencia de DNA de Mycobacterium en momias peruanas de hace unos 1.000 años también se demostró recientemente (ver El origen de la tuberculosis en América, en microBIO).

Quizá, como hemos dicho al principio, la co-evolución del patógeno y el ser humano ha sido en parte beneficioso para ambos. La infección latente por Mycobacterium ha podido generar una cierta protección inmunológica frente a otros patógenos. Afirmar que la tuberculosis ha podido ser beneficiosa para la humanidad no deja de ser algo arriesgado y paradójico si tenemos en cuenta que esta bacteria es responsable de cerca de 1,3 millones de muertes cada año, pero se calcula que más de 2.000 millones de personas pueden tener una infección latente que nunca se manifestará como enfermedad, algo que la evolución ha mantenido a lo largo de miles de años. Cabe preguntarse entonces si Mycobacterium tuberculosis puede considerarse un patógeno o un simbionte.

(1) Co-evolution of Mycobacterium tuberculosis and Homo sapiens. Brites D, Gagneux S. Immunol Rev. 2015. 264(1):6-24. doi: 10.1111/imr.12264.

(2) Genomic insights into tuberculosis. Galagan JE. Nat Rev Genet. 2014. 15(5):307-20. doi: 10.1038/nrg3664.

martes, 21 de julio de 2015

CSI: descubrir al asesino por las bacterias de su pelo


Aplicaciones forenses del análisis metagenómico de las bacterias presentes en el pelo

Seguro que habrás visto algún capítulo de la serie CSI en el que Grissom coge con sumo cuidado un pelo en la escena del crimen. Si el pelo en cuestión mantiene la raíz es relativamente fácil extraer el DNA y hacer un análisis del perfil genómico, que si coincide con el sospechoso, permite demostrar que el susodicho estuvo en la escena del crimen. Aunque el pelo es una de las muestras más empleadas en la investigación forense, a veces no permite un análisis tan preciso. Si el pelo es cortado o carece de raíz, la cantidad de DNA que se extrae es mucho menor y el análisis mucho más difícil.


El conjunto de microbios que viven en tu cuerpo se llama microbiota y todos los genomas de esos microbios es el microbioma. El estudio del microbioma humano ha demostrado que la composición de bacterias no solo es diferente en cada parte del cuerpo sino que también es distinta entre individuos, lo que podría ser interesante desde el punto de vista de la investigación forense.

Ahora por primera vez, a un grupo de australianos (1) se les ha ocurrido analizar la composición microbiana del pelo humano, para ver si podría tener interés forense. La pregunta que querían responder era si la composición bacterias del pelo es diferente según las personas y si esto podría ser empleado como herramienta forense adicional al análisis clásico del DNA.

Para ello, han empleado muestras de pelo de siete individuos sanos, tres hombres y cuatro mujeres de entres 23 y 53 años de edad. Además, dos de ellos eran pareja. Los voluntarios cogieron muestras de su propio pelo de la cabeza y del pubis, en tres tiempos diferentes, al comienzo del estudio y dos y cinco meses después. Se extrajo el DNA de las muestras, en concreto de tres pelos, se concentró el DNA, se amplificó mediante PCR y se realizó una secuenciación masiva. Los datos se analizaron bioinformáticamente para determinar la composición de bacterias en la muestra.

Los resultados demostraron que los datos obtenidos de las muestras de pelo del pubis tenían un mayor potencial para aplicaciones forense que los del pelo de la cabeza. El microbioma del pelo de la cabeza era muy similar en todos los individuos y no parece tener una aplicación forense clara.

La composición microbiana del pelo del pubis fue muy similar en cada persona a lo largo del estudio, lo que sugiere que es bastante estable. Además, el microbioma del pelo del pubis, a diferencia del pelo de la cabeza, parece estar menos influenciado por factores ambientales.


Sí que hubo diferencias entre sexos en la composición microbiana del pelo del pubis: el pelo de las mujeres tenía una mayor cantidad de bacterias del grupo Lactobacillus, prácticamente ausentes en el pelo de los hombres. Este dato, por ejemplo, permitía diferenciar claramente el origen del pelo según el sexo del indivuduo. La presencia de Lactobacillus se puede explicar porque este grupo bacteriano es característico y uno de los más frecuente en la vagina. Además, comparado con el pelo del pubis de los hombres, el de las mujeres tenía mayor diversidad microbiana.

Los datos obtenidos de las dos personas (un hombre y una mujer) que eran pareja fueron muy interesantes. El microbioma del pelo del pubis fue muy diferente entre ellos en las dos primeras muestras (tomadas al inicio y a los dos meses). Sin embargo, la composición fue muy similar en la última muestra, tomada en el quinto mes.  Resulta que, a diferencia de en las dos primeras muestras, esta pareja había mantenido relaciones íntimas antes de la toma de la última muestra de pelo. Según los investigadores, este resultado sugiere que durante el acto sexual puede haber también cierta mezcla de la microbiota, que explicaría, por ejemplo, la aparición de Lactobacillus en la última muestra del pelo del hombre. Las muestras de la pareja compartían más microbios que las de los individuos que no eran pareja.

Durante el acto sexual también puede haber transferencia de bacterias ente las dos personas

La comparación de todos lo datos sugiera también que todos los individuos tenían algunos grupos microbianos propios y únicos en la muestra de pelo del pubis, lo que podría llegar a tener valor en la investigación forense. Dicho de otra forma, se podría diferenciar el pelo de cada individuo por el perfil de bacterias presentes en el mismo.

Este estudio se ha realizado solo con siete individuos, y solo dos de ellos eran pareja. Como sugieren los mismos autores, son necesarios más análisis con un mayor número de muestras. Sin embargo, los datos sugieren que el análisis del microbioma del pelo del pubis puede ser tener interés como herramienta forense, especialmente en aquellos casos de un acto de violencia sexual. Este análisis podría ayudar a asociar a la víctima con el asaltante.

Habrá que estar atentos a la próxima temporada de CSI: seguro que incorporan esta nueva técnica entre sus análisis.

(1) Metagenomic analyses of bacteria on human hairs: aqualitative assessment for applications in forensic science. Tridico, S. R., y col. Investig Genet. 2014. 5 (1): 16. doi: 10.1186/s13323-014-0016-5.

viernes, 17 de julio de 2015

Las bacterias también se “vacunan”: el sistema CRISPR/Cas

Sobrevivir a una infección viral es fundamental para cualquier forma de vida. Para controlar una infección es necesario que el virus invasivo sea capturado por las células para su reconocimiento específico y posterior destrucción. Es lo que se denomina inmunidad adaptativa. En los mamíferos, este sistema se basa en la respuesta antígeno-anticuerpo. Pero las bacterias y las arqueas (los procariotas) no tiene este sistema de antígenos-anticuerpos. ¿Cómo se protegen entonces frente a una infección viral?

En los procariotas existe también un sistema de defensa que confiere inmunidad adaptativa frente a los virus (bacteriófagos) que les infectan, el denominado CRISPR/Cas del inglés “Clustered Regularly Interspaced Short Palindromic Repeats”, algo así como repeticiones palidrómicas cortas interespaciadas agrupadas regularmente, un nombre que seguro no te dice nada.

CRISPR/Cas es el sistema de defensa inmune adaptativo de las bacterias, capaz de reconocer un DNA extraño y degradarlo

¿Cómo es el sistema CRISPR/Cas?

El sistema CRISPR/Cas tiene dos componentes: un grupo de secuencias de DNA repetidas varias veces y agrupadas (CRISPR), y unas proteínas con actividad endonucleasa (Cas, del inglés “CRISPR-associated sequence”, secuencias asociadas a CRISPR).


Secuencias CRISPR/Cas en el cromosoma de una bacteria. El sistema incluye un conjunto, denominado array CRISPR, de varias secuencias de DNA espaciadoras alternadas con secuencias palindrómicas (*) repetidas. Estas secuencia repetidas son idénticas y tienen un tamaño entre 21 y 47 pares de bases.  Las secuencias espaciadoras tienen un tamaño constante pero su secuencia de DNA es hipervariable y derivan del DNA de bacteriófagos y plásmidos con los que la bacteria ha tenido contacto previamente. Todo el array CRISPR se transcribe como un único RNAm, bajo el control de una secuencia promotora reguladora que se encuentra en la secuencia leader.  Además, existen otros genes asociados a CRISPR, denominados genes Cas, del inglés “CRISPR-associated sequences” que codifican para las proteínas Cas con actividad endonucleasa y que cortan el DNA extraño reconocido.

El primer artículo que hace referencia a este sistema es de 1987 (1), en el que analizan el genoma de Escherichia coli y describen por primera vez unas secuencias que se repetían una y otra vez, separadas por otras secuencias a las que denominaron espaciadores. Varios años después, en el 2000, el español Martínez Mójica (2) de la Universidad de Alicante describió esas mismas secuencia en arqueas y las denominó SRSRs, Short Regularly Spaced Repeats. Hoy sabemos que las secuencias CRISPR/Cas se encuentran en aproximadamente el 40% de los genomas de las bacterias secuenciados y el 90% de los de las arqueas. El sistema es más complejo y ya se han descrito de momento tres tipos diferentes de sistemas CRISPR/Cas en procariotas.

Entrevista al investigador Francisco J. Martínez Mójica en El Mundo (29/05/2015)

Mediante el sistema CRISPR/Cas los procariotas son capaces de incorporar a su genoma un fragmento del DNA invasor que servirá de guía para evitar futuras invasiones

¿Cómo funciona CRISPR/Cas?

CRISPR/Cas es un sistema de defensa que permite a la bacteria interferir con la infección de un fago. Pero no lo hace ni bloqueando la entrada del fago o de su DNA, ni mediante el sistema enzimático clásico de restricción-modificación, ni mediante un sistema que aborte la infección viral. El sistema es mucho más sofisticado y se activa cuando la bacteria es infectada por un virus que inyecta su DNA extraño al interior de la bacteria. Parte del DNA del virus (o de un plásmido) se incorpora como secuencia espaciador en el genoma de la bacteria entre las secuencias CRISPR. Posteriormente, se transcribe el array CRISPR y se produce un RNA de interferencia que contiene esa secuencia CRISPR espaciadora incorporada. Este RNA es capaz de guiar a las enzimas Cas hacia una secuencia de DNA complementaria (de un nuevo virus similar al anterior que infecte la bacteria) y degradarlo.  Las enzimas Cas, por tanto, son guiadas por el RNA y cortan y empalman el DNA donde le “dice” el RNA.

Es un efectivo sistema de defensa de la bacteria (sistema inmune adaptativo) contra el virus. Podríamos decir que la bacteria queda “vacunada” contra ese virus. Además, la secuencia del virus a destruir queda así almacenada como información en el genoma de la bacteria y de sus descendientes.

CRISPR/Cas es un sistema de defensa bacteriano que escanea el DNA extraño y si lo reconoce lo destruye


El array CRISPR se transcribe entero como un único RNAm que luego se corta en sitios específicos en cada repetición dando lugar a pequeños RNAs maduros (crRNAs, CRISPR RNA). Cada crRNA contiene una secuencia espaciadora entera más dos pequeños trozos de las regiones repetidas adyacentes. El corte preciso se hace por el complejo de proteínas Cas. Algunas de esta proteínas permanecen unidas al crRNA para formar un agente de defensa activo. La secuencia del espaciador del crRNA es capaz de reconocer y guiar al complejo a la secuencia diana específica, y entonces algunas de la proteínas con actividad endonucleasa cortan el DNA “invasor” . Como todos los espaciadores se transcriben y se procesan en agentes de defensa activos, la bacteria está continuamente en guardia frente a cualquier fago o plásmido invasor.

Una nueva revolución en biología molecular

Después de la invención de la PCR y de los nuevos sistemas de secuenciación masiva, pocos pensaban que habría otra invención que volvería a revolucionar las técnicas de ingeniería genética y biología molecular. Pero el sistema de defensa bacteriano CRISPR/Cas está teniendo unas aplicaciones hasta ahora increíbles. El concepto es simple, modificando la secuencia del crRNA podemos hacer que el sistema corte la secuencia de DNA que nosotros queramos.

En 2012, la estadounidense Jennifer Doudna y la francesa Emmanuelle Charpentier publicaron en la revista Science (3) cómo el sistema CRISPR/Cas puede adaptarse para transformarlo en un método de edición genética muy preciso, eficaz, barato, sencillo, no tóxico, aplicable a todo tipo de DNA, de animales y plantas, que permite modificar el DNA, hacer mutaciones, inserciones, deleciones, y regular la expresión génica para editar y silenciar genomas.

CRISPR/Cas es el mejor “editor de textos” que se ha inventado hasta ahora para manipular el genoma de cualquier ser vivo


CRISPR/Cas ha transformado ya la tecnología en biología y sus aplicaciones biotecnológicas, biomédicas y de terapia génica son ya una revolución. La posibilidad de manipular la información genética mediante CRISPR/Cas abre la puerta a cambiar radicalmente el tratamiento y la investigación de un gran número de enfermedades y se considera ya uno de los principales hallazgos en la última década de la biomedicina. J. Doudna y E. Charpentier han sido galardonadas con el premio Princesa de Asturias de Investigación Científica y Técnica 2015.

De nuevo la revolución viene de la mano de las bacterias (y arqueas). Primero fueron las enzimas de restricción que actúan como unas “tijeras” capaces de cortar el DNA en sitios específicos. Luego las DNA polimerasas de arqueas permitieron el desarrollo de la amplificación específica de secuencias de DNA mediante la PCR. Y ahora, el sistema de defensa CRISPR/Cas. Ya nadie duda de que el algún día el Nobel premiará estas investigaciones.

Video sobre cómo funciona el sistema CASPR/Cas (en inglés, 4:12)



También te puede interesar “La revolución CRISPR/Cas” en Curiosidades de la Microbiología de Manuel Sánchez.

(*) Una secuencia palindrómica es una secuencia de ácido nucleico (DNA o RNA) que es lo mismo si se lee en una dirección en una hebra que en la otra dirección en la hebra complementaria, con la que forma una doble hélice. Por ejemplo:
ATTGGCGGTTAACCGCCAAT
TAACCGCCAATTGGCGGTTA


(2) Biological significance of a family of regularly spacedrepeats in the genomes of Archaea, Bacteria and mitocondria. Mojica, F. J., y col. Molecular microbiology, 2000; 36 (1): 244–246.

(3) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Jinek, M., y col. Science. 2012; 337 (6096): 816-21.
doi: 10.1126/science.1225829.


lunes, 13 de julio de 2015

La ardilla de oro: el juego de ciencia de este verano

La pregunta microBIO

El blog Metros por segundo, de Borja González Seoane ha organizado el mejor juego de ciencia de este verano: La ardilla de oro. 

Se trata de saltar de un blog a otro respondiendo una pregunta sobre un tema científico

El juego comienza ya: hoy lunes 13 de julio a las 11:00 am (hora peninsular española)
  
La pregunta microBIO es:
¿Cuál es la bacteria más grande que se conoce hasta ahora?


Para comenzar a jugar, aquí tienes el enlace a las instrucciones y a la primera pregunta del concurso La ardilla de oro, en Metros por Segundo

Ahora, tienes que saltar a la siguiente pregunta, 
en el blog de Félix Moronta

¿Te has perdido?
Siguiendo tu hoja de ruta, has llegado de DNA Didactisc y debes saltar al siguiente árbol, que es Félix Moronta.


Suerte y ánimo!, a por todas!

ATENCIÓN: Ya tenemos ganador de la primera edición de
 La ardilla de oro: enhorabuena!

La respuesta a nuestra pregunta ¿Cuál es la bacteria más grande que se conoce hasta ahora? es: Thiomargarita namibiensisuna bacteria marina filamentosa descubierta en 1999 capaz de oxidar el azufre, del grupo de las gamma-proteobacterias, con un tamaño de unas 750 micras. Está bacteria forma cadenas y acumula en su interior gránulos de azufre brillantes, por eso los autores le pusieron ese nombre que significa “perlas de azufre de Namibia”. De momento, es la bacteria más grande que se conoce. Referencia: Science.